The circular DNA molecules in prokaryotes usually contain ____________________ replication forks during replication, while linear eukaryotic DNA contains many more. DNA Structure and Replication Answer Section TRUE/FALSE 1.
Or each chromosome of a pair can be individually picked. 16. Explain two ways in which children can have different chromosomes (gene variation) than their mother or father. Random separation of chromosomes (law of segregation) when forming sperm/ova during anaphase I, crossing over of some genes to the homologous chromosomes during prophase I, and mutation during S
The nucleotide sequence on the template strand of the gene. ACA b. The mRNA codon that results after this triplet code is transcribed. UCU c. The anticodon on the tRNA molecule that is complementary to the mRNA codon described above. AGA d. The amino acid that would be carried by the tRNA molecule described above.
Synthesis of polypeptide chains is protein The chains produce specfic proteins based on the genetic code in DNA. This occurs in two stages, which is transcription and translation. The transcription stage occurs in the nucleus where the DNA contains the cistrons/genes that code for specific polypeptides. The transcribing stand is the part of the strand that forms the cistron. The strand acts as a template and is transcribed to mRNA.
Name: ______________________ Protein Synthesis Matching bases of DNA & RNA ! Match RNA bases to DNA C G bases on one of the DNA strands U C A AG C RNA A C C polymerase G A U G G A A C A U C Matching bases of DNA & RNA ! U instead of T is matched to A aa aa aa G U U DNA mRNA TACGCACATTTACGTACGCGG! aa aa A U AUGCGUGUAAAUGCAUGCGCC! aa aa aa aa ribosome aa T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology!
What is the genome? The total component of DNA in a living organism. One section of our DNA that does not code for gene. Spacer DNA is the section of our DNA that does not code for gene. What is phenotype?
Associate Program Material DNA Worksheet Answer the following in at least 100 words: Describe the structure of DNA DNA structure consists of a polymer that is made up of subunits called nucleotides. DNA looks like a spiral staircase this is a double helix. Each spiral strand is created from sugar phosphate and any attached bases, when the strands line up and connect the bases also match up. DNA consists of many different nucleobases named adenine, thymine, guanine and cytosine. Only two of these will connect those two are adenine and thymine the other two guanine and cytosine won’t How does an organism’s genotype determine its phenotype?
This enzyme can work on 5; 3; direction so it duplicates the leading stand continuously. The DNA ligase enzyme repairs the single strand breaks into duplex DNA in living organisms using the complimentary strands. The Okazaki fragments are being shaped and connected together to form short double stranded DNA sections. C. In decoding the genetic information of a cell, transcription is the first step. An enzyme called RNA Polymerase, builds RNA molecules that complement a portion of one of the 2 strands of the DNA helix.
The bases used in DNA replication are adenine (A), thymine (T), guanine (G), and cytosine (C). In RNA, uracil (U) is used instead of thymine, but in this case, that is irrelevant. Generally, in a normal human being, A is matched up with T, and G is matched up with C to makeup the complementary base pairs. An important step in the initiation of the replication process is the binding of the RNA primase. This primase attracts the nucleotides that bind to the corresponding nucleotides of the 3’-5’ strand.
The plasma membrane acts as a selective barrier between the cell and its environment, and is a structure that you will study in detail throughout the year. The nucleus consists of a limiting double bilayer nuclear envelope containing nuclear pores enclosing the nucleoplasm. Small, irregular particles scattered throughout the nucleus or accumulated adjacent to the nuclear envelope are clumps of condensed chromatin known as heterochromatin. They consist of protein and DNA and stain with basic dyes. When the chromatin is dispersed and not readily stainable, it is known as euchromatin.