Protein Synthesis: Regents Biology

768 Words4 Pages
] Protein Synthesis Bodies ! Cells ! DNA ! Bodies are made up of cells ! All cells run on a set of instructions spelled out in DNA DNA ! Cells ! Bodies ! How does DNA code for cells & bodies? " how are cells and bodies made from the instructions in DNA Regents Biology! Regents Biology! DNA ! Proteins ! Cells ! Bodies ! ____________________________________ " How do proteins do all the work ! ____________________ " " _____________ proteins run living organisms __________________ ! control all chemical reactions in living organisms " __________________ ! all living organisms are built out of proteins proteins cells DNA gets all the glory, Proteins do all the work Regents Biology! bodies…show more content…
_____________________ ! DNA strand is the template (pattern) " match bases ! U : A ! G : C ! ________________ ! ________________ ! Enzyme " RNA polymerase Regents Biology! Regents Biology! Matching bases of DNA & RNA ! Double stranded DNA unzips Matching bases of DNA & RNA ! Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology! Regents Biology! Name: ______________________ Protein Synthesis Matching bases of DNA & RNA ! Match RNA bases to DNA C G bases on one of the DNA strands U C A AG C RNA A C C polymerase G A U G G A A C A U C Matching bases of DNA & RNA ! U instead of T is matched to A aa aa aa G U U DNA mRNA TACGCACATTTACGTACGCGG! aa aa A U AUGCGUGUAAAUGCAUGCGCC! aa aa aa aa ribosome aa T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology! A C C A U G U C G A U C A G U A G C A U G G C A Regents Biology! cytoplasm aa aa aa aa aa aa How does mRNA code for proteins ! mRNA leaves nucleus ! mRNA goes to ribosomes in cytoplasm ! ____________________________________

More about Protein Synthesis: Regents Biology

Open Document