The two heavy chains are about 400 amino acids long, and the two light chains about half that long. Each heavy chain has a hinge region where the antibody is bent, giving the monomer a T or Y shape Y 4. Activity 4: Western Blotting Technique Lab Report 1. Describe why the HIV Western blot is a more specific test than the indirect ELISA for HIV. Your answer: The HIV Western blot has a discrete protein band that represents the specific antigen the antibody is recognizing, while the ELISA uses a well that corresponds to a mixture of antigens.
To confirm this idea, Marshall Nirenberg used a synthetic RNA containing only one kind of base. What question was his experiment attempting to answer? 8. Briefly describe Seymour Benzer’s experiment that answered the question: “Do mutations in the DNA sequence of a gene correlate with protein changes?” 9. Marshall Nirenberg and Heinrich Matthaei used mRNA made up of repeating uracil nucleotides in a cell free extract.
What is meant by homozygous and heterozygous? Homozygous→ When the alleles from both parent are the same. Heterozygous→ When the alleles from both parents are different. 21. What did Gregor Mendel contribute to the study of biology and what 7 plant traits did he study?
6) Which amino acid has the highest Rf value. Why? Phenylalanine has the highest Rf value because it is the most non-polar and therefore has the lowest affinity for the polar stationary phase. 7) Which amino acid has the lowest Rf value. Why?
Your Full Name: UMUC Biology 102/103 Lab 6: Taxonomy INSTRUCTIONS: * On your own and without assistance, complete this Lab 6 Answer Sheet electronically and submit it via the Assignments Folder by the date listed in the Course Schedule (under Syllabus). * To conduct your laboratory exercises, use the Laboratory Manual located under Course Content. Read the introduction and the directions for each exercise/experiment carefully before completing the exercises/experiments and answering the questions. * Save your Lab 6 Answer Sheet in the following format: LastName_Lab6 (e.g., Smith_Lab6). * You should submit your document as a Word (.doc or .docx) or Rich Text Format (.rtf) file for best compatibility.
Find the start codon to set the reading frame and then translate as far as possible: DNA strand 3’AAATACGGGAAAGGGCCCCTAACTCCCCCCCGC5’ How many amino acids would the polypeptide that this mRNA produces contain? (a) 5 (b) 6 (c) 7 (d) 10 Question 18 Which of the following amino acids are present in the polypeptide that you have just produced in Question 17? (a) ser (b) tyr (c) leu (d) asp (e) ala. The Genetic Code The table below lists the codons as they occur in mRNA, read in the 5'-3' direction. U C A G U UUU
To support their hypothesis Beadle and Tatum showed that some of the mutants forms of Neurospora could not live without a particular amino acid or vitamin added to their food source. These mutants were shown to be missing one particular enzyme which led to a blocked metabolic pathway. They showed that the mutation of a particular gene precented the production of a particular enzyme- the one gene-one enzyme hypothesis. Explain why the one gene-one protein hypothesis was modified to one gene-one polypeptide. It was shown that some proteins consisted of several different polypeptide chains and each different polypeptide chain has its own gene, e.g.
From the gel electrophoresis, we found that the PCR product was about 600 bps. Spectrometric analysis helped us to find the concentration of amplified DNA which was about 65 μL/mL. The next step was to produce digoxigenin-UTP labelled RNA probe by in vitro transcription of PCR amplified tau DNA with T7 RNA polymerase. About 4 μL of template DNA was added to a sterile, RNase-free reaction vial. The total sample volume was made up to 13 μL by adding water.
a. GgWw b. GGWW c. ggWW d. GGww e. ggww Check your work. Answer is e. If the genotype of an individual is to be tested, the best cross to perform is the testcross, to a homozygous recessive. All of the other crosses will allow potential recessive alleles in the yellow round
24 linkage groups, 22 pairs of autosomes, and the X and the Y 13. Markers may be variable restriction sites, variable short repeated sequences, or single nucleotide polymorphisms (SNPs). 14. Linkage: inherited together as on the same chromosome. Marker: a gene or DNA sequence with a known location that can be used to localize a gene of interest with an unknown location.