R10 Unit 1 Test

1125 Words5 Pages
Test your knowledge Match the correct functions For each of the enzymes in questions, 1-5, choose an answer (a-e) that most closely describes the functions of the enzymes Question 1 helicase Question 2 DNA polymerase 1 Question 3 ligase Question 4 DNA polymerase 111 Question 5 RNA polymerase Answers (a) removes the RNA primers during replication (b) performs transcription (c) unwinds DNA for DNA replication (d) adds nucleotides during DNA replication (e) forms phosphodiester bonds between Okazaki fragments Question 6 Which of the following are the nucleotides found in RNA (a) A, C, G, T (b) A, C, G, U (c) T, C, G, U (d) A, T, G, U (e) U, C, T, A…show more content…
(b) a small RNA primer and a stretch of DNA which are complimentary to the 5' to 3' strand of the following diagram. (c) no primer just a stretch of DNA which is complimentary to the 3' to 5' strand of the following diagram. (d) no primer just a stretch of DNA which is complimentary to the 5' to 3' strand of the following diagram. 3'_________________ 5' 5'----------------------------…show more content…
Find the start codon to set the reading frame and then translate as far as possible: DNA strand 3’AAATACGGGAAAGGGCCCCTAACTCCCCCCCGC5’ How many amino acids would the polypeptide that this mRNA produces contain? (a) 5 (b) 6 (c) 7 (d) 10 Question 18 Which of the following amino acids are present in the polypeptide that you have just produced in Question 17? (a) ser (b) tyr (c) leu (d) asp (e) ala. The Genetic Code The table below lists the codons as they occur in mRNA, read in the 5'-3' direction. U C A G U UUU

More about R10 Unit 1 Test

Open Document