Chargaff’s observations established the ____________________ ____________________ rules, which describe the specific pairing between bases on DNA strands. 23. Watson and Crick used the X-ray ____________________ photographs of Wilkins and Franklin to build their model of DNA. 24. Due to the strict pairing of nitrogen bases in DNA molecules, the two strands are said to be ____________________ to each other.
This can be due to number of things. Timing and aseptic procedure are two main causes of variability. Introduction Genetic Transformation is a type of genetic recombination that allows competent bacteria cells to pick up DNA fragments from the environment and express the genes in the fragments (Kovach, 2012). In 1928, a British Medical Officer by the name of Fredrick Griffith published a report titled “The Significance of Pneumococcal Types.”
The liquid of homogenate was filtered into a beaker through Miracloth (2 layers cloth) to remove large plant components and 1 ml of the filtrate was transferred to a conical tube. 8.4 g of ammonium sulfate was slowly added to the 40 ml of the filtrate as it was stirred on a stir plate for 15 min to achieve 37% saturation (210g/L of solution). The solution was then centrifuged at a speed of 9000 x g at 4oC for 15 min to sediment the proteins. The resultant supernatant 1 was transferred to a beaker with 1 ml transferred to a conical tube and the obtained pellet 1 was resuspended in 4 ml of distilled water and transferred into a dialysis bag to remove the salt. Then, 3.4 g of ammonium sulfate was slowly added to the supernatant 1 as it was stirred for 15 min to achieve 50% saturation (85g/L of solution).
Marshall Nirenberg and Heinrich Matthaei used mRNA made up of repeating uracil nucleotides in a cell free extract. They obtained amino acid chains consisting of phenylalanine. What did they learn when they asked the question, ”What happens when mRNA made up of only cytosine, alanine, and guanine are placed in a cell free extract?” 10. Explain how the structure of tRNA helps it to deliver the correct amino acid to the corresponding mRNA codon at the ribosome. Sketch the structure of a tRNA molecule, making sure to label the amino acid and the
Name: ______________________ Protein Synthesis Matching bases of DNA & RNA ! Match RNA bases to DNA C G bases on one of the DNA strands U C A AG C RNA A C C polymerase G A U G G A A C A U C Matching bases of DNA & RNA ! U instead of T is matched to A aa aa aa G U U DNA mRNA TACGCACATTTACGTACGCGG! aa aa A U AUGCGUGUAAAUGCAUGCGCC! aa aa aa aa ribosome aa T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology!
Procedure: 1. Fill a beaker two-thirds full of water and add approximately 20 drops of IKI. Write down the solution's color and record the mass of the bag. 2. Do an initial Benedict's test on the 15% glucose/1% starch and the beaker solutions for glucose by putting some of the solution and a roughly equal amount of blue Benedict's solution in a test tube, placing the test tube in boiling water for 90 seconds, and observing whether or not the solution changes color from blue.
The known nutrient solutions were used to create a base-line for protein, starch, and sugars. As listed in Table 1; protein (5g/L), Starch (0.2g/L), and sugar (20g/L) were separated in to 9 different test tubes at 2ml a piece, 3 per nutrient solution and tested for colormetry with the 400ug of the three reagents Lugol’s, Biuret, and Benedicts. Further steps were taken with the nutrients treated with Benedict’s reagent and they were heated in a water bath until they reached a constant 65 degrees C for 7 minutes and let cool to see color change. Distinguishing Organic Molecules in Unknown Dietary Supplements The same reagents used in setting the baseline were used to test the unknowns for nutrient content. Each of the 3 unknowns was distributed by dispensing 2ml of sample solution in to three test tubes.
Test your knowledge Match the correct functions For each of the enzymes in questions, 1-5, choose an answer (a-e) that most closely describes the functions of the enzymes Question 1 helicase Question 2 DNA polymerase 1 Question 3 ligase Question 4 DNA polymerase 111 Question 5 RNA polymerase Answers (a) removes the RNA primers during replication (b) performs transcription (c) unwinds DNA for DNA replication (d) adds nucleotides during DNA replication (e) forms phosphodiester bonds between Okazaki fragments Question 6 Which of the following are the nucleotides found in RNA (a) A, C, G, T (b) A, C, G, U (c) T, C, G, U (d) A, T, G, U (e) U, C, T, A
Gizmo Warm-up The Building DNA Gizmo™ allows you to construct a DNA molecule and go through the process of DNA replication. Examine the components that make up a DNA molecule. 1. What are the two DNA components shown in the Gizmo? The DNA components shown in the Gizmo are phosphate molecules and deoxyribose sugars 2.
For every 20 drops of solution you will add 0.1g of zinc to the new test tube. Repeat steps 3 and four until the solution is clear. If there ever exists too little of the solution to get enough drops, add up to 1mL of distilled water to the solution. 4. Once the solution is clear, retrieve at least ten drops of the solution and place them in a new test tube.