The enzyme that is responsible for replicating molecules of DNA by attaching complementary bases in the correct sequence is called ____________________ ____________________. 27. Enzymes called ____________________ are responsible for unwinding the DNA double helix by breaking the hydrogen bonds that hold the complementary strands together. 28. Errors in nucleotide sequences are called ____________________.
Name: ______________________ Protein Synthesis Matching bases of DNA & RNA ! Match RNA bases to DNA C G bases on one of the DNA strands U C A AG C RNA A C C polymerase G A U G G A A C A U C Matching bases of DNA & RNA ! U instead of T is matched to A aa aa aa G U U DNA mRNA TACGCACATTTACGTACGCGG! aa aa A U AUGCGUGUAAAUGCAUGCGCC! aa aa aa aa ribosome aa T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology!
Associate Program Material DNA Worksheet Answer the following in at least 100 words: Describe the structure of DNA DNA structure consists of a polymer that is made up of subunits called nucleotides. DNA looks like a spiral staircase this is a double helix. Each spiral strand is created from sugar phosphate and any attached bases, when the strands line up and connect the bases also match up. DNA consists of many different nucleobases named adenine, thymine, guanine and cytosine. Only two of these will connect those two are adenine and thymine the other two guanine and cytosine won’t How does an organism’s genotype determine its phenotype?
The nucleotide sequence on the template strand of the gene. ACA b. The mRNA codon that results after this triplet code is transcribed. UCU c. The anticodon on the tRNA molecule that is complementary to the mRNA codon described above. AGA d. The amino acid that would be carried by the tRNA molecule described above.
RNA primase lays the beginning for DNA Primase to begin laying down the nucleobases: Adenine, Thymine, Cytosine and Guanine. 3. Okazaki fragment from RNA primase a segment of the lagging strand during replication. 4. DNA ligase goes over all the small Okazaki segments and binds them into a new strand of DNA.
Marshall Nirenberg and Heinrich Matthaei used mRNA made up of repeating uracil nucleotides in a cell free extract. They obtained amino acid chains consisting of phenylalanine. What did they learn when they asked the question, ”What happens when mRNA made up of only cytosine, alanine, and guanine are placed in a cell free extract?” 10. Explain how the structure of tRNA helps it to deliver the correct amino acid to the corresponding mRNA codon at the ribosome. Sketch the structure of a tRNA molecule, making sure to label the amino acid and the
Explain how DNA replicates? What are some characteristics of the structure of DNA? Explain complementary base pairing. 15. Describe in detail the phases of mitosis.
stores proteins and alot of exporting (sending stuff out of the cell) 3. In which part of the cell would you expect to find nucleotides? building block for DNA, DNA found in the nucleus 4. Name the two organelles involved in energy conversion.chloroplast and mitochondria 5. What are the basic functions of the organelles in chapter 4?
The plasma membrane acts as a selective barrier between the cell and its environment, and is a structure that you will study in detail throughout the year. The nucleus consists of a limiting double bilayer nuclear envelope containing nuclear pores enclosing the nucleoplasm. Small, irregular particles scattered throughout the nucleus or accumulated adjacent to the nuclear envelope are clumps of condensed chromatin known as heterochromatin. They consist of protein and DNA and stain with basic dyes. When the chromatin is dispersed and not readily stainable, it is known as euchromatin.
codon 2. Amino acids are the monomers of what macromolecule? protein 3. Be able to use the codon chart (aka “Universal Genetic