codon 2. Amino acids are the monomers of what macromolecule? protein 3. Be able to use the codon chart (aka “Universal Genetic
To form a strand of DNA, nucleotides are linked into chains, with the phosphate and sugar groups alternating (. DNA has a double helix structure and has two strands running in opposite directions (UIC, 2013). 2. How does an organism’s genotype determine its phenotype? Genotype determines the genetic makeup of an individual organism.
To confirm this idea, Marshall Nirenberg used a synthetic RNA containing only one kind of base. What question was his experiment attempting to answer? 8. Briefly describe Seymour Benzer’s experiment that answered the question: “Do mutations in the DNA sequence of a gene correlate with protein changes?” 9. Marshall Nirenberg and Heinrich Matthaei used mRNA made up of repeating uracil nucleotides in a cell free extract.
BIOL-110 Elements of Biology Assignment 1 Student Name: Part A: Multiple Choice Questions and Fill in the Blanks 1) A covalent chemical bond is one in which * c) Outer-shell electrons of two atoms are shared 2) Which of the following is not a weak molecular interaction? * a) A covalent bond 3) Polysaccharides, lipids, and proteins are similar in that they * b) Are synthesized from monomers by dehydration reactions. 4) Which of the following is a compartment that often takes up much of the volume of a plant cell? * b) Vacuole 5) The presence of cholesterol in the plasma membranes of some animals * a) Enables the membrane to stay fluid more easily when cell temperature drops 6) Which of the following types of molecules are the major structural
RNA primer labeled at top. Further information: DNA replication#The replication fork The lagging strand is that strand of the DNA double helix that is orientated in a 5' to 3' manner. Therefore, its complement must be synthesized in a 3'→5' manner. Because DNA polymerase III cannot synthesize in the 3'→5' direction, the lagging strand is synthesized in short segments known as Okazaki fragments. Along the lagging strand's template, primase builds RNA primers in short bursts.
The two heavy chains are about 400 amino acids long, and the two light chains about half that long. Each heavy chain has a hinge region where the antibody is bent, giving the monomer a T or Y shape Y 4. Activity 4: Western Blotting Technique Lab Report 1. Describe why the HIV Western blot is a more specific test than the indirect ELISA for HIV. Your answer: The HIV Western blot has a discrete protein band that represents the specific antigen the antibody is recognizing, while the ELISA uses a well that corresponds to a mixture of antigens.
1) What is the primary structure of a protein? The primary structure is a linear sequence of how amino acids are arranged in a polypeptide chain. These interactions form a covalent backbone. 2) Why isn’t there free rotation around the peptide bond? Because the amino nitrogen associated within the peptide bond has a lone pair, this allows for a resonance structure to take place.
Find the start codon to set the reading frame and then translate as far as possible: DNA strand 3’AAATACGGGAAAGGGCCCCTAACTCCCCCCCGC5’ How many amino acids would the polypeptide that this mRNA produces contain? (a) 5 (b) 6 (c) 7 (d) 10 Question 18 Which of the following amino acids are present in the polypeptide that you have just produced in Question 17? (a) ser (b) tyr (c) leu (d) asp (e) ala. The Genetic Code The table below lists the codons as they occur in mRNA, read in the 5'-3' direction. U C A G U UUU
The unknown sample’s Rf values were 0.42, 0.82. The Rf values suggest that components of the unknown sample are Lysine and Phenylalanine. 9) Explain the structure of the amino acid that determines its polarity or non-polarity. The polarity or non-polarity of an amino acid is determined by the R group of the amino acid. Every amino acid has a
0.5 out of 0.5 points | | | In prokaryotes there is one origin of replicationAnswer | | | | | Selected Answer: | True | Correct Answer: | True | | | | | * Question 5 0.5 out of 0.5 points | | | Introns are removed from the primary transcripts of eukaryotes by the spliceosomeAnswer | | | | | Selected Answer: | True | Correct Answer: | True | | | | | * Question 6 0 out of 0.5 points | | | Who showed that the genetic material of bacterial viruses was DNA by labeling the DNA with radioactive phosphorous?Answer | | | | | Selected Answer: | [None Given] | Correct Answer: | Hershey and Chase | | | | | * Question 7 0 out of 0.5 points | | | While a ribosome is synthesizing a protein a given tRNA will move from theAnswer | | | | | Selected Answer: | [None Given] | Correct Answer: | A ⇒ P ⇒ E sites | | | | | * Question 8 0 out of 0.5 points | | | What kind of DNA damage does the photorepair action of photolyase fixAnswer | | | | | Selected Answer: | [None Given] | Correct Answer: | Thymine dimer | | | |