Name: ______________________ Protein Synthesis Matching bases of DNA & RNA ! Match RNA bases to DNA C G bases on one of the DNA strands U C A AG C RNA A C C polymerase G A U G G A A C A U C Matching bases of DNA & RNA ! U instead of T is matched to A aa aa aa G U U DNA mRNA TACGCACATTTACGTACGCGG! aa aa A U AUGCGUGUAAAUGCAUGCGCC! aa aa aa aa ribosome aa T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology!
Errors in nucleotide sequences are called ____________________. 29. Errors in nucleotide sequencing are corrected by enzymes called ____________________ ____________________. 30. The circular DNA molecules in prokaryotes usually contain ____________________ replication forks during replication, while linear eukaryotic DNA contains many more.
Explain how DNA replicates? What are some characteristics of the structure of DNA? Explain complementary base pairing. 15. Describe in detail the phases of mitosis.
Associate Program Material DNA Worksheet Answer the following in at least 100 words: Describe the structure of DNA DNA structure consists of a polymer that is made up of subunits called nucleotides. DNA looks like a spiral staircase this is a double helix. Each spiral strand is created from sugar phosphate and any attached bases, when the strands line up and connect the bases also match up. DNA consists of many different nucleobases named adenine, thymine, guanine and cytosine. Only two of these will connect those two are adenine and thymine the other two guanine and cytosine won’t How does an organism’s genotype determine its phenotype?
codon 2. Amino acids are the monomers of what macromolecule? protein 3. Be able to use the codon chart (aka “Universal Genetic
DNA ligase goes over all the small Okazaki segments and binds them into a new strand of DNA. 5. DNA polymerase replaces the RNA primer and DNA ligase binds the segments. (Hank, 2013) mRNA Transcription (slide 4) 1. mRNA 2. DNA (Hank, 2013) mRNA Transcription (slide 5) 1.
To form a strand of DNA, nucleotides are linked into chains, with the phosphate and sugar groups alternating (. DNA has a double helix structure and has two strands running in opposite directions (UIC, 2013). 2. How does an organism’s genotype determine its phenotype? Genotype determines the genetic makeup of an individual organism.
This primase attracts the nucleotides that bind to the corresponding nucleotides of the 3’-5’ strand. It is these RNA nucleotides that initiate the binding of DNA nucleotides, and are thus called primers. The leading strand receives a single primer while the lagging strand receives multiple primers. Ligase,
What question does Sydney Brenner ask in “Defining the gene?” Explain why this was an important question to understand how DNA codes for protein. How does the sequence of bases correspond to the sequence of amino acids? 7. George Gamow thought that three bases in DNA corresponded to one amino acid. To confirm this idea, Marshall Nirenberg used a synthetic RNA containing only one kind of base.
Find the start codon to set the reading frame and then translate as far as possible: DNA strand 3’AAATACGGGAAAGGGCCCCTAACTCCCCCCCGC5’ How many amino acids would the polypeptide that this mRNA produces contain? (a) 5 (b) 6 (c) 7 (d) 10 Question 18 Which of the following amino acids are present in the polypeptide that you have just produced in Question 17? (a) ser (b) tyr (c) leu (d) asp (e) ala. The Genetic Code The table below lists the codons as they occur in mRNA, read in the 5'-3' direction. U C A G U UUU